This is a working overview of NADH, written for readers who want more than a one-paragraph summary but less than a textbook.
Reviewed 2026-08-01. Anything still debated is marked as such rather than presented as settled.
In glycolysis, NAD+ accepts electrons during the oxidation of glyceraldehyde-3-phosphate, forming NADH. The tricarboxylic acid cycle and fatty acid oxidation also generate NADH, which donates electrons to the mitochondrial electron transport chain. This flow supports ATP synthesis and helps maintain the redox balance of the cell. Other dehydrogenases use NAD+ as a cofactor for biosynthetic reductions and detoxification reactions. NADH is later reoxidized to sustain continued flux through these pathways.
Beyond electron transfer, NAD+ serves as a substrate for enzymes that cleave the molecule and transfer ADP-ribose units. Sirtuins, poly(ADP-ribose) polymerases, and CD38 consume NAD+ in regulatory reactions. These activities link NAD+ availability to DNA repair, chromatin modification, calcium signaling, and metabolic stress responses. Because consumption can exceed biosynthesis under some conditions, cellular NAD+ levels are dynamic rather than fixed. Enzyme affinity and local synthesis also influence how much NAD+ is available for signaling.
NAD+ is a dinucleotide composed of adenine, ribose, and nicotinamide moieties linked by phosphate groups. Its oxidized form carries a positive charge on the nicotinamide ring, which enables reversible hydride transfer. The molecule functions as a coenzyme in oxidoreductase reactions rather than as a dietary vitamin in its intact form. Cells maintain separate pools in cytoplasm, mitochondria, and nucleus. This compartmentalization allows distinct redox environments while preserving a shared chemical identity.
Quality control for NAD+ materials typically combines identity, purity, and water content checks. Identity may be confirmed by ultraviolet spectrum, retention time in chromatography, or mass accuracy, while purity is assessed by HPLC peak area or quantitative nuclear magnetic resonance. Residual water and solvents can affect molar calculations and enzyme assays, so Karl Fischer titration or thermogravimetric analysis may be used. Commercial materials vary in grade and counterion form, and published methods should specify the exact salt or hydrate when reporting concentrations. Regulatory status depends on intended use, with research reagents, dietary ingredients, and clinical products treated under different frameworks.
Quantification of NAD+ in biological samples usually relies on separation techniques coupled to sensitive detection. High-performance liquid chromatography with ultraviolet detection can measure the oxidized form by its absorbance near 260 nm, while mass spectrometry provides greater specificity and can distinguish NAD+ from close analogs. Enzymatic cycling assays use coupled dehydrogenase reactions to amplify signal and estimate NAD+ concentrations in cell or tissue extracts. Because NAD+ and NADH interconvert rapidly, sample preparation must quench metabolism quickly and preserve the redox state before analysis.
| Property | Value | Notes |
|---|---|---|
| Chemical name | Nicotinamide adenine dinucleotide | Oxidized form abbreviated NAD+ |
| Molecular formula | C21H27N7O14P2 | Free acid form |
| Molar mass | 663.43 g/mol | Calculated for free acid |
| CAS Registry Number | 53-84-9 | Common entry for beta-NAD+ |
| Appearance | White to off-white powder | Hygroscopic solid |
Cells produce NAD+ through several biosynthetic routes. The salvage pathway recycles nicotinamide, while the Preiss-Handler pathway uses nicotinic acid, and a de novo route can start from tryptophan in some organisms. In mammals, the salvage pathway is generally considered the main source under ordinary conditions. Tissue concentrations vary widely by cell type and compartment, and measured declines with age have been reported in some studies. Whether such changes drive aging or mainly accompany it remains an open question.
Nicotinamide adenine dinucleotide, commonly abbreviated NAD+, is a coenzyme present in all living cells. The molecule consists of two nucleotides linked by phosphate groups, with adenine and a nicotinamide ring as its principal features. In its oxidized form, the nicotinamide ring can accept a hydride ion, becoming NADH. This reversible conversion places NAD+ at the center of many electron-transfer reactions. Its role as a redox carrier is well established across bacteria, plants, fungi, and animals.
In humans, NAD+ can be synthesized from nicotinic acid, nicotinamide, nicotinamide riboside, and tryptophan through overlapping pathways. The salvage pathway recycles nicotinamide back to NAD+ and is often considered a major route in many tissues. Dietary precursors and intracellular recycling both contribute to the pool, but the quantitative importance of each source remains an active research question. NAD+ levels are not uniform across organs or cell compartments. Measurements in blood do not necessarily reflect concentrations inside tissues.
NAD+ is a dinucleotide composed of nicotinamide, ribose, and adenine linked by phosphate groups. Its full name is nicotinamide adenine dinucleotide, with "+" denoting the oxidized form. The molecule acts as a coenzyme in redox reactions, cycling between NAD+ and NADH. In cells, it participates in electron transfer during glycolysis, the citric acid cycle, and oxidative phosphorylation. It is distinct from NADP+, which carries an additional phosphate group and supports different biosynthetic reactions.
Beyond redox chemistry, NAD+ serves as a substrate for enzymes that transfer ADP-ribose or remove acetyl groups. Sirtuins, PARPs, and CD38-family enzymes consume NAD+ and produce nicotinamide and ADP-ribose-related products. These reactions link NAD+ availability to DNA repair, chromatin modification, and cellular signaling. Because the molecule is central to energy metabolism and regulation, changes in its concentration are studied in aging, immunity, and metabolic research. The balance between synthesis and consumption varies by tissue, developmental stage, and physiological state.
Stability studies show that NAD+ can hydrolyze under prolonged heat, extreme pH, or microbial contamination. Phosphate buffers near neutral pH are often used for short-term handling, though exact stability depends on concentration, temperature, and matrix. In biological samples, endogenous enzymes can rapidly degrade NAD+, making cold chain and fast processing important. Analytical reports should state extraction conditions, internal standards, and validation parameters. Without those details, comparisons across studies remain difficult and potentially misleading.
Laboratory measurement of NAD+ often begins with rapid quenching of cell or tissue samples to prevent enzymatic conversion. Acidic or alkaline extraction can precipitate proteins, but the chosen method affects recovery of oxidized and reduced forms. Enzymatic cycling assays provide high sensitivity by amplifying a NAD+-dependent reaction. High-performance liquid chromatography and mass spectrometry offer separation and structural confirmation. Each method has trade-offs in throughput, specificity, and the ability to distinguish NAD+ from close analogues.
Purified NAD+ is typically supplied as a white to off-white powder and stored desiccated at low temperature. Airtight containers limit moisture uptake, while protection from light reduces degradation of the nicotinamide ring. Aqueous stock solutions are less stable than solid material and are often aliquoted before freezing. Repeated freeze-thaw cycles can lower integrity, so working portions are kept separate. Purity is commonly checked by ultraviolet absorbance near 260 nm, high-performance liquid chromatography, or mass spectrometry.
In redox reactions, NAD+ accepts a hydride ion, which consists of two electrons and one proton. The hydride adds to the nicotinamide ring at a specific carbon, converting NAD+ into NADH. Dehydrogenase enzymes use this step in glycolysis, the citric acid cycle, and fatty acid oxidation. NADH later donates electrons to the mitochondrial electron transport chain, helping to drive ATP synthesis. The balance between NAD+ and NADH reflects the metabolic state of a cell, and shifts in that balance can alter how pathways operate.
Beyond electron transfer, NAD+ serves as a substrate for enzymes that cleave it and attach its ADP-ribose portion to other molecules. This group includes poly(ADP-ribose) polymerases, CD38, and sirtuins. Such reactions consume NAD+ and can influence its availability for metabolism. Cells replenish NAD+ through a salvage pathway that recycles nicotinamide and through routes starting from tryptophan or vitamin B3 forms. How these synthesis and consumption routes are coordinated across tissues remains an active area of study, and compartment-specific concentrations are difficult to measure directly.
Nicotinamide adenine dinucleotide, abbreviated NAD+, is a dinucleotide built from adenine, nicotinamide, two ribose sugars, and two phosphate groups. The oxidized form carries a positive charge on the nicotinamide ring, while the reduced form, NADH, is neutral. This pair acts as a reversible electron carrier in cells. NAD+ is present in bacteria, plants, animals, and fungi. Its structure allows it to accept and donate electrons without being consumed in the reactions it supports.
complementary DNA (cDNA) Also copy DNA. DNA that is synthesized from a single-stranded RNA template (typically mRNA or miRNA) in a reaction catalyzed by the enzyme reverse transcriptase. cDNA is produced both naturally by retroviruses and artificially in certain laboratory techniques, particularly molecular cloning. In bioinformatics, the term may also be used to refer to the sequence of an mRNA transcript expressed as its DNA coding strand counterpart (i.e. with thymine replacing uracil).
The sequence of a gene can be altered in a number of ways. Gene mutations have varying effects on health depending on where they occur and whether they alter the function of essential proteins. Mutations in the structure of genes can be classified into several types.
In autumn 1981 he visited Liverpool again, this time with a thirty-strong task force of representatives of local employers and civil servants (unusually for the time, drawn from different departments – DOE, DTI and Employment, but not the Home Office this time – Heseltine had been pushing for greater cooperation between departments since the setting up of the European Space Agency in 1973). For the next fifteen months he visited Liverpool for a day almost every week, refusing police protection and often driving himself, persuading business and local government to work together. Colette Bowe, a DTI official who was deputy director of the task force, recorded that Heseltine was the most effective minister she had ever seen at getting the official machine to do his bidding through a mixture of charm and tough questions.
Tyrosine kinases recruited to a receptor following hormone binding are receptor-associated tyrosine kinases and are involved in a number of signaling cascades, in particular those involved in cytokine signaling (but also others, including growth hormone). One such receptor-associated tyrosine kinase is Janus kinase (JAK), many of whose effects are mediated by STAT proteins. (See JAK-STAT pathway.)
== Early life and education == Badu-Tawiah is from rural Ghana. He was one of three graduates of a high school class of 500 that went on to attend university. He earned his bachelor's and master's degree at the Kwame Nkrumah University of Science and Technology. In 2005 he moved to the United States, where he joined the laboratory of R. Graham Cooks at Purdue University to study high-performance liquid chromatography. There he studied reactions in mass spectrometers, and started to investigate whether this unique environment could be used for synthesis. Whilst at Purdue, Badu-Tawiah was awarded several research fellowships, including the Andrews and Lilly Innovation Fellowships. In 2012 Badu-Tawiah joined Harvard University where he worked in the research laboratory of George M. Whitesides. There he developed paper-based systems capable of performing molecular recognition. In particular, Badu-Tawiah looked to develop macrofluidic platforms that could analyse for specific biomarkers. Unfortunately, the enzymes required to detect biomarkers on paper-based platforms are not stable and require careful storage.
Sources: en.wikipedia.org
Directed by Sheila Hayman, made by Uden Associates 8 November Rebuilding Berlin, how German telecommunication and electrical engineers found great difficulty in connecting the infrastructure and technology of East and West Berlin, which were largely totally incompatible, and why the two technological systems were so different; East and West Germany were founded in 1953; the trains in East (Deutsche Reichsbahn or DR) and West Germany ran on electric motors that worked in opposite ways; Erich Kratky of Berliner Verkehrsbetriebe (former West Berlin Public Transport) and how East Berlin drivers had 60% of those in West Berlin; Mahlow station, on the S2 line on the Berlin S-Bahn, was completely rebuilt in 1991, opening on 31 August 1992; before 1989, West Berlin could not connect to any neighbouring electrical power networks, so had to make all of its own power itself, by nine power stations; in 1992 West Berlin could not make enough electrical power;Jürgen Beyer of the East Berlin Electricity Board; in 1992 East and West Germany could not connect their electricity systems together; Klaus Krämer of the West Berlin Electricity Board, and how East German load frequency control (LFC) was not good enough for West Germany; East German power stations were polluting; Müggelsee in East Berlin; East Berlin had natural gas - from Russia - but West Berlin did not have natural gas, and had to produce its own gas from processing, and there were many more gas leaks in East Berlin, run by the Berlin Gas Board, and British Gas plc was installing most of the new plastic gas mains in East Berlin; one fifth of housing in East Berlin was uninhabitable, due to lack of renovation and unsafe electrical wiring; much housing in East Berlin did not have any bathrooms; the post system in East Berlin was three times slower than West Berlin, as it was all sorted by hand, and mail hand to be sent in standard envelopes only, in East Germany - the two post systems were incompatible, and East and West Germany had totally different postcode systems, although both had four digits, so a letter was put in front of each Deutsche Post postcode, to show if it was an East or West German postcode; in 1952, telephone connections between East and West Germany were stopped, but four lines were installed in 1972; the East German telephone exchanges were all mechanical, and could not transmit any digital communications; one in ten people in East Berlin had a phone - telecommunications in East Berlin were hopeless and expensive; in 1992 Deutsche Telekom connected East and West Berlin, and the price would be a local call, not the price of an international call, under the phrase Wir schaffen Verbingdungen; not only were East German telecommunications often impossible, but the Stasi secret police were listening in to most calls; Rudolf Reichel of the former East German Economic Institute; science research in East Germany had been greatly restricted; Volker Hassemer; East Germans viewed West Germans as selfish, and West Germans viewed East Germans as backward. Narrated by Su-Lin Looi, directed by Cosima Dannoritzer, produced by Karl Sabbagh, made by Skyscraper Productions 15 November 21st Century Jet, how the Boeing 777 moved from the drawing board to manufacture in 1992, with the innovative new method called CATIA; the Boeing 777 was the largest jet aircraft to have been developed mostly by computer, with assembly beginning in January 1993; there were 10,000 people in the 777 programme, who met the managers in a weekly meeting; meeting the needs of Robert Crandall of American Airlines, and competition from the new Airbus A340; parts of the tail were built in Australia; the nose cone and flaps were made in Italy; the landing gear was made in Canada, the US, and France; parts of the wing ribs and passenger doors were made in Japan; the nose landing gear door was made in Belfast; some of the electronics was made in England; there were about 230 design teams, from different manufacturers; the CATIA system was a digital mockup; Thomas Gaffney, head of passenger doors; Henry Shomber, one of the chief engineers; John Roundhill, a chief project engineer; United Airlines placed the first order, which started the project; Al Tyler of Aerospace Technologies of Australia (ASTA), who made the 777 rudder - the company became Boeing Australia; John King, Baron King of Wartnaby of British Airways visits to look at legroom for the new 777. Narrated by Simon Prebble, directed by Karl Sabbagh, made by Skyscraper Productions 22 November The Puzzle of HIV, scientists after ten years did not understand how HIV worked; immunologists Anthony Fauci and Max Essex; Angus Dalgleish of St George's, University of London; virologist Stephen S. Morse, and the origination of viruses, and how most pandemics originated in China; Stella Knight of the MRC, and dendritic cells, researched by Brigid Balfour; French immunologist Jean-Claude Ameisen of the Pasteur Institute of Lille; virologist Jonas Salk; Claude Nicolau, and the CD4 glycoprotein. Narrated by Scottish actress Sandra Clark, directed by Nigel Maslin, produced by Chris Haws, made by InCA Productions 29 November The Alpha Link, much of medical understanding of radiation protection and health comes from what occurred in Japan in August 1945. Martin Gardner (1940–93), an epidemiologist, and Professor of Medical Statistics at the University of Southampton, thought that health was affected by working in a nuclear power station, which the British nuclear industry vehemently would not believe. Directed by Vivienne King, made by Box Productions 6 December Toying with the Future, about electronic children's toys, visiting Ocean Software in Manchester; Brian Sutton-Smith of the University of Pennsylvania, and how toys were small replicas of large world events; Eugene F. Provenzo of the University of Miami and how the culture of childhood began in the early 1700s, and how German Friedrich Fröbel developed educational toys in the early 1800s, but it often lacked fun; Meccano Ltd sets, developed by Frank Hornby, launching the international Meccano Guild network of children's mechanical clubs in 1919, publicised by the Meccano Magazine; Richard Gregory, neuropsychologist at the University of Bristol, and his Exploratory Hands-on Science Centre, which closed in 1999, replaced by We the Curious in 2000; toy designer Patrick Rylands; Gary Bracey of Ocean Software; Keith Tinman, computer game musician; Elizabeth Curran of GameTek; Ocean Software designers Ray Coffey, James Higgins and Dawn Drake. Directed by Christopher Rawlence, produced by Debra Hauer, made by Rawlence Hauer Productions 13 December The Elements, a repeat of the 20 October 1991 episode 20 December E.T. Please Phone Earth, about the SETI Institute, with Prof Philip Morrison, a professor of physics at MIT, who played a starring if not dangerous role in the Manhattan Project; Jill Tarter at the Hat Creek Radio Observatory in California; Dr John Billingham, a British medical doctor at the Ames Research Center in California; Prof Antony Hewish of the University of Cambridge, who discovered pulsars in 1967; Frank Drake, and his work at the National Radio Astronomy Observatory in Green Bank, West Virginia; Barney Oliver of SETI; David Blair of the University of Western Australia; Paul Horowitz of Harvard University; the Ohio State University Radio Observatory (known as Big Ear) and its 1977 Wow! signal; Jack Cohen; chemist Stanley Miller and his 1953 experiment; blind SETI investigator Kent Cullers; and biologist Jared Diamond from UCLA. Jointly made with ABC of Australia, narrated by Heather Couper, directed by Richard Smith, produced by Stuart Carter, made by Pioneer Productions
Simple branched alkanes often have a common name using a prefix to distinguish them from linear alkanes, for example n-butane, isobutane (or i-butane) for the two isomers of butane and n-pentane, isopentane, neopentane for the three isomers of pentane. IUPAC naming conventions can be used to produce a systematic name. The key steps in the naming of more complicated branched alkanes are as follows:
CTCCAACATCAAGGAAGATGGCATTTCTAG (sequence source: US FDA ETEPLIRSEN BRIEFING DOCUMENT NDA 206488), 30-mer, 20% G, 43% CG, Predicted Tm: 88.9 °C at 10 μM oligo. Oligo complement CTAGAAATGCCATCTTCCTTGATGTTGGAG DMD-001 Exon 51, ENST00000357033.8 in Ensembl.org, RNA target site marked. Given that the target site is within an exon, this is likely blocking binding of an exonic splice enhancer protein and so altering splicing by interfering with splice regulation. CTCCTACTCAGACTGTTACTCTGGTGACACAACCTGTGGTTACTAAGGAAACTGCCATCT CCAAA[CTAGAAATGCCATCTTCCTTGATGTTGGAG]GTACCTGCTCTGGCAGATTTCAACC GGGCTTGGACAGAACTTACCGACTGGCTTTCTCTGCTTGATCAAGTTATAAAATCACAGA GGGTGATGGTGGGTGACCTTGAGGATATCAACGAGATGATCATCAAGCAGAAG
=== October === 9 October Críostóir Ó Floinn, 95, writer. Hugh Friel, 71, drummer (The Atrix). 10 October – Dónal O'Neill, 56, Gaelic footballer (Edenderry, Offaly senior team). 13 October – Hugh Russell, 63, boxer, Olympic bronze medallist (1980). 15 October – Gerry Ryan, 68, footballer (Bohemians, Derby County, Brighton, national team). 17 October – Paul Reynolds, 50, cricket umpire. 29 October – Jimmy Duggan, 93, hurler (Liam Mellows, Galway senior team, Connacht). 31 October – Séamus Leydon, 81, Gaelic footballer (Dunmore MacHales, Nemo Rangers, Galway senior team, Connacht).
One mixed-mode column can replace two or even more single mode columns, which is economic and eco-friendly for employing the stationary phase more sufficiently and reducing the consuming and ‘waste’ of raw materials. Single mixed-mode column can be applied for on-line two-dimensional (2D) analysis in a sealed system via establishing corresponding chromatographic system or off-line 2D analysis as two columns.
Sources: en.wikipedia.org
NAD+ is the oxidized form, while NADH is the reduced form carrying an additional hydride equivalent. The pair participates in reversible electron transfer reactions. Their ratio helps indicate the redox state of a compartment.
NAD+ itself is not classified as a vitamin, but its precursor niacin is an essential nutrient in humans. Cells synthesize NAD+ from niacin, nicotinamide, nicotinamide riboside, or tryptophan. The intact dinucleotide is not obtained directly from typical diets in meaningful amounts.
Age-related studies often examine whether NAD+ levels decline in tissues and whether that decline affects mitochondrial function or DNA repair. Interventions using precursor molecules raise open questions about cause and effect. Current evidence does not establish that changing NAD+ levels slows human aging.
Common methods include LC-MS, HPLC with UV detection, and enzymatic cycling assays. Rapid quenching is needed because NAD+ and NADH interconvert. The chosen method should be validated for the sample matrix.