This is a working overview of salvage pathway, written for readers who want more than a one-paragraph summary but less than a textbook.
Reviewed 2026-05-27. Anything still debated is marked as such rather than presented as settled.
Beyond redox catalysis, NAD+ is a substrate for enzymes that transfer ADP-ribose or remove acetyl groups from proteins. Sirtuins and poly(ADP-ribose) polymerases consume NAD+ and release nicotinamide as a byproduct. These reactions connect cellular energy status to gene regulation, DNA repair, and stress responses. Because NAD+ is used rather than merely recycled in such signaling, its concentration reflects both biosynthesis and consumption. The balance between salvage and de novo synthesis pathways determines available pools in different tissues.
Biosynthesis of NAD+ starts from nicotinamide, nicotinic acid, or nicotinamide riboside through salvage pathways. A rate-limiting enzyme, nicotinamide phosphoribosyltransferase, converts nicotinamide to nicotinamide mononucleotide. Further coupling with ATP yields NAD+. In mammals, the liver and muscle can synthesize NAD+ from dietary precursors, but tissue levels vary widely. Researchers study these pathways to understand age-related changes, metabolic disorders, and neurodegeneration. Direct causal links between NAD+ decline and disease remain an active area of investigation.
Cells produce NAD+ through several biosynthetic routes. The salvage pathway recycles nicotinamide, while the Preiss-Handler pathway uses nicotinic acid, and a de novo route can start from tryptophan in some organisms. In mammals, the salvage pathway is generally considered the main source under ordinary conditions. Tissue concentrations vary widely by cell type and compartment, and measured declines with age have been reported in some studies. Whether such changes drive aging or mainly accompany it remains an open question.
Nicotinamide adenine dinucleotide, commonly abbreviated NAD+, is a coenzyme present in all living cells. The molecule consists of two nucleotides linked by phosphate groups, with adenine and a nicotinamide ring as its principal features. In its oxidized form, the nicotinamide ring can accept a hydride ion, becoming NADH. This reversible conversion places NAD+ at the center of many electron-transfer reactions. Its role as a redox carrier is well established across bacteria, plants, fungi, and animals.
Beyond redox chemistry, NAD+ acts as a substrate for several enzyme families. ADP-ribosyltransferases, sirtuins, and CD38 ectoenzymes cleave the molecule into nicotinamide and ADP-ribose or related products. These reactions connect NAD+ availability to processes such as DNA repair, chromatin modification, and calcium signaling. Because the coenzyme is used in both electron transfer and signaling, cells maintain separate pools in compartments including the cytosol, mitochondria, and nucleus. The relative sizes and regulation of those pools remain active areas of study.
| Property | Value | Notes |
|---|---|---|
| Chemical formula | C21H27N7O14P2 | Applies to the free acid form of beta-NAD+ |
| Molar mass | 663.43 g/mol | Calculated from the free acid formula |
| Redox couple | NAD+/NADH | Standard reduction potential near -0.32 V at pH 7 |
| Primary role | Electron carrier | Participates in oxidoreductase reactions |
| Common synonym | Diphosphopyridine nucleotide | Historical abbreviation DPN |
Commercial NAD+ is available at research grade, often with purity specifications determined by high-performance liquid chromatography. Certificates of analysis may report water content, residual solvents, and counterion identity. Identity can be confirmed by ultraviolet absorbance near 260 nm, mass spectrometry, or enzymatic activity. Because different salt forms and hydration states exist, researchers should verify that the product matches the intended molecular form. Lot-to-lot variation in purity can affect quantitative assays and should be documented.
Solid NAD+ is usually supplied as a white to off-white powder or lyophilized preparation. It is hygroscopic and should be kept desiccated at low temperature, commonly -20 °C or below for long-term storage. Aqueous solutions are less stable than dry material and are often prepared fresh or stored frozen in aliquots. Light exposure and repeated freeze-thaw cycles can promote degradation, so amber containers and single-use aliquots are preferred. Buffered solutions near neutral pH are generally less stable than acidic or frozen preparations.
In cells, NAD+ functions primarily as an electron carrier. Dehydrogenase enzymes in glycolysis and the citric acid cycle transfer hydride from substrates to NAD+, producing NADH. NADH then delivers electrons to the mitochondrial respiratory chain, supporting ATP synthesis. In fermentation, NADH is reoxidized to NAD+ so that glycolysis can continue. The balance between NAD+ and NADH helps set metabolic flux. Beyond redox, NAD+ serves as a substrate for enzymes that cleave it, including sirtuins, poly(ADP-ribose) polymerases, and CD38. These reactions consume NAD+ and release nicotinamide and ADP-ribose products.
Biosynthesis occurs through salvage, Preiss-Handler, and de novo pathways. In mammals, the salvage pathway from nicotinamide predominates, and NAMPT is often described as rate-limiting. Nicotinamide riboside and nicotinic acid enter related routes that converge on NAD+ production. Tissue NAD+ concentrations vary widely and are maintained by a balance of synthesis and consumption. Some studies report age-related declines in certain tissues, but whether these changes cause disease or can be reversed to improve human health remains an open question.
NAD+ stands for nicotinamide adenine dinucleotide, the oxidized form of a coenzyme found in all living cells. The molecule consists of two nucleotides, adenine and nicotinamide ribose, joined through phosphate groups. Its chemical formula is C21H27N7O14P2, and the free acid has a molar mass near 663.43 grams per mole. In redox reactions, NAD+ accepts a hydride ion and becomes NADH. The pair NAD+ and NADH participates in hundreds of metabolic reactions, including steps in glycolysis, the citric acid cycle, and oxidative phosphorylation.
For some individuals who experience difficulty in achieving full glanular engorgement of glans penis, they may be diagnosed with soft glans syndrome (glans insufficiency syndrome). It is often undiagnosed in the general population due to the lack of a standardized nomenclature.
The Cherokee Nation has legislative, executive and judicial branches with executive power vested in the principal chief, legislative power in the Tribal Council, and judicial power in the Tribal Supreme Court. The principal chief, deputy chief, and tribal council are elected to four-year terms by the registered tribal voters over the age of 18. The nation's current system of government was established by the constitution of 1999, which was adopted by tribal citizens in 2003, and implemented in 2006. Every 20 years, the constitution requires a vote among tribal members, to decide whether a new constitutional convention should be held. The Congress of the United States, the federal courts, and state courts have repeatedly upheld the sovereignty of Native Tribes, defining their relationship in political rather than racial terms, and have stated it is a compelling interest of the United States. This principle of self-government and tribal sovereignty is controversial. According to the Boston College sociologist and Cherokee, Eva Marie Garroutte, up to 32 separate definitions of "Indian" are used in federal legislation, as of a 1978 congressional survey. The 1994 Federal Legislation AIRFA (American Indian Religious Freedom Act) defines an Indian as one who belongs to an Indian Tribe, which is a group that "is recognized as eligible for the special programs and services provided by the United States to Indians because of their status as Indians."
== People with the name == Link (singer) (Lincoln Browder, born 1964), American R&B singer Link (surname) Charles Lincoln "Link" Neal III of Rhett & Link (born 1978), American comedian and YouTuber Link Wray (1929–2005), American rock-and-roll guitarist
== Chemistry == Chemically, dipipanone belongs to the class of opioids called the 4,4-diphenylheptane-3-ones. It closely resembles methadone, the only structural difference being the N,N-dimethyl moiety of methadone being replaced with a piperidine ring. Other related compounds with equivalent activity where the piperidine ring has been replaced by other groups, include the morpholine derivative phenadoxone, as well as the corresponding pyrrolidine derivative dipyanone. The synthesis is the same as for phenadoxone, with the exception that piperidine is used in lieu of morpholine. Related compounds with an isoquinuclidine ring such as nufenoxole are also known.
The ionizing radiation emitted by radium bromide excites nitrogen molecules in the air, making it glow. The alpha particles emitted by radium quickly gain two electrons to become neutral helium, which builds up inside and weakens radium bromide crystals. This effect sometimes causes the crystals to break or even explode. Radium nitrate (Ra(NO3)2) is a white compound that can be made by dissolving radium carbonate in nitric acid. As the concentration of nitric acid increases, the solubility of radium nitrate decreases, an important property for the chemical purification of radium. Radium forms much the same insoluble salts as its lighter congener barium: it forms the insoluble sulfate (RaSO4, the most insoluble known sulfate), chromate (RaCrO4), carbonate (RaCO3), iodate (Ra(IO3)2), tetrafluoroberyllate (RaBeF4), and nitrate (Ra(NO3)2). With the exception of the carbonate, all of these are less soluble in water than the corresponding barium salts, but they are all isostructural to their barium counterparts. Additionally, radium phosphate, oxalate, and sulfite are probably also insoluble, as they coprecipitate with the corresponding insoluble barium salts. The great insolubility of radium sulfate (at 20 °C, only 2.1 mg will dissolve in 1 kg of water) means that it is one of the less biologically dangerous radium compounds. The large ionic radius of Ra2+ (148 pm) results in weak ability to form coordination complexes and poor extraction of radium from aqueous solutions when not at high pH.
Sources: en.wikipedia.org
==== Intracrine ==== In intracrine signaling, the signaling chemicals are produced inside the cell and bind to cytosolic or nuclear receptors within the cell. This type of signaling sets it apart from the other cell signaling mechanisms such as autocrine signaling. In both autocrine and intracrine signaling, the signal has an effect on the cell that produced it.
== Name == The Socialist Republic of Bosnia and Herzegovina was formed during a meeting of the State Anti-fascist Council for the National Liberation of Bosnia and Herzegovina (ZAVNOBiH) in Mrkonjić Grad on 25 November 1943. In April 1945, its name was formalized as the Federated State of Bosnia and Herzegovina (Serbo-Croatian: Federalna Država Bosna i Hercegovina / Федерална Држава Босна и Херцеговина), a constituent unit of the Democratic Federal Yugoslavia. With DF Yugoslavia changing its name to the Federal People's Republic of Yugoslavia on 29 November 1945 as well as the promulgation of the 1946 Yugoslav Constitution two months later in January, its constituent units also changed their respective names. FS Bosnia and Herzegovina thus became known as the People's Republic of Bosnia and Herzegovina (Narodna Republika Bosna i Hercegovina / Народна Република Босна и Херцеговина). This constitutional system lasted until the 1963 Yugoslav Constitution. On 7 April 1963, Yugoslavia was reconstituted as the Socialist Federal Republic of Yugoslavia, and PR Bosnia and Herzegovina changed its name to the Socialist Republic of Bosnia and Herzegovina (Socijalistička Republika Bosna i Hercegovina / Социјалистичка Република Босна и Херцеговина). After independence on 1 March 1992, the country was renamed to the Republic of Bosnia and Herzegovina. Following the Dayton Agreement that was in force, it became simply a federated state known as Bosnia and Herzegovina in 1997.
Pyrite.Virtual Museum of Mineralogy. Universidad de Zaragoza, Spain Educational article about the famous pyrite crystals from the Navajun Mine How Minerals Form and Change "Pyrite oxidation under room conditions". Poliakoff, Martyn (2009). "Fool's Gold". The Periodic Table of Videos. University of Nottingham.
In pre-life, a 31 nucleotide D loop minihelix (GCGGCGGUAGCCUAGCCUAGCCUACCGCCGC) was ligated to two 31 nucleotide anticodon loop minihelices (GCGGCGGCCGGGCU/???AACCCGGCCGCCGC; / indicates a U-turn conformation in the RNA backbone; ? indicates unknown base identity) to form the 93 nucleotide tRNA precursor. To generate type II tRNAs, a single internal 9 nucleotide deletion occurred within ligated acceptor stems (CCGCCGCGCGGCGG goes to GGCGG). To generate type I tRNAs, an additional, related 9 nucleotide deletion occurred within ligated acceptor stems within the variable loop region (CCGCCGCGCGGCGG goes to CCGCC). These two 9 nucleotide deletions are identical on complementary RNA strands. tRNAomes (all of the tRNAs of an organism) were generated by duplication and mutation. Very clearly, life evolved from a polymer world that included RNA repeats and RNA inverted repeats (stem-loop-stems). Of particular importance were the 7 nucleotide U-turn loops (CU/???AA). After LUCA (the last universal common (cellular) ancestor), the T loop evolved to interact with the D loop at the tRNA "elbow" (T loop: UU/CAAAU, after LUCA). Polymer world progressed to minihelix world to tRNA world, which has endured for ~4 billion years. Analysis of tRNA sequences reveals a major successful pathway in evolution of life on Earth.
With each successive cycle, the original template strands plus all newly generated strands become template strands for the next round of elongation, leading to exponential (geometric) amplification of the specific DNA target region. The processes of denaturation, annealing and elongation constitute a single cycle. Multiple cycles are required to amplify the DNA target to millions of copies. The formula used to calculate the number of DNA copies formed after a given number of cycles is 2n, where n is the number of cycles. Thus, a reaction set for 30 cycles results in 230, or 1,073,741,824 copies of the original double-stranded DNA target region. Final elongation: This single step is optional, but is performed at a temperature of 70–74 °C (158–165 °F) (the temperature range required for optimal activity of most polymerases used in PCR) for 5–15 minutes after the last PCR cycle to ensure that any remaining single-stranded DNA is fully elongated. Final hold: The final step cools the reaction chamber to 4–15 °C (39–59 °F) for an indefinite time, and may be employed for short-term storage of the PCR products.
Sources: en.wikipedia.org
== Commercial production == Commercial onion powders are prepared using dehydration, freeze-drying, vacuum-shelf drying and flow drying. Some commercial onion powders are irradiated as a treatment against potential microbial contamination. It readily absorb water upon contact, so commercial varieties may be packaged in airtight containers with a liner atop the container. Onion powder with a moisture content of 4–5 percent is prone to caking when stored in warmer environments, with increased temperatures corresponding to a shorter time for the occurrence of caking. It is generally accepted that commercial onion powder is around ten times stronger in flavor compared to fresh onions.
In addition to Colonel Lilly, his brother, James, and son, Josiah (J. K.), the company employed other Lilly family. Colonel Lilly's cousin, Evan Lilly, was hired as a bookkeeper. Lilly's grandsons, Eli and Josiah Jr. (Joe) joined the company from a young age. Under J. K.'s leadership, the company introduced scientific management concepts, organized the company's research department, increased its sales force, and began international distribution of its products. For the rest of the late 19th century, Lilly operated in Indianapolis and the surrounding area as many other pharmaceutical businesses did, manufacturing and selling "sugar-coated pills, fluid extracts, elixirs, and syrups". The company used plants for its raw materials and produced its products by hand. One historian noted, "Although the Indianapolis firm was more careful in making and promoting drugs than the patent medicine men of the era, the company remained ambivalent about scientific research."
== Medical uses == Recombinant human epidermal growth factor, sold under the brand name Heberprot-P, is used to treat diabetic foot ulcers. It can be given by injection into the wound site, or may be used topically. Tentative evidence shows improved wound healing. Safety has been poorly studied. EGF is used to modify synthetic scaffolds for manufacturing of bioengineered grafts by emulsion electrospinning or surface modification methods.
=== Antagonists and inverse agonists === Non-selective Agouti-related peptide Agouti signalling peptide MC2-selective Atumelnant (CRN04894) MC4-selective HS-014 HS-024 MCL-0042 MCL-0129 MPB-10 SHU-9119 (agonist at MC1 and MC5, antagonist at MC3 and MC4)
Sources: en.wikipedia.org
NAD+ is the oxidized form and NADH is the reduced form of the same coenzyme. NAD+ accepts electrons during oxidation reactions, becoming NADH, which can donate electrons in other reactions. The ratio between them helps describe a cell's redox state.
No; NAD+ and related dinucleotides occur across bacteria, archaea, plants, fungi, and animals. Its central role in electron transfer and enzyme catalysis is deeply conserved, though specific pathways for making and using it can differ among organisms.
NAD+ is a charged, water-soluble dinucleotide and generally does not diffuse freely across cell membranes. Cells rely on precursor molecules and dedicated transport or salvage pathways. This limited permeability shapes how researchers deliver or measure NAD+ in experimental systems.
NAD+ is a coenzyme found in living cells and is the oxidized form of nicotinamide adenine dinucleotide. It accepts electrons in redox reactions and also serves as a substrate for certain signaling and repair enzymes.